Here's how NATURE.COM makes money* and how much!

*Please read our disclaimer before using our estimates.
Loading...

NATURE . COM {}

  1. Analyzed Page
  2. Matching Content Categories
  3. CMS
  4. Monthly Traffic Estimate
  5. How Does Nature.com Make Money
  6. How Much Does Nature.com Make
  7. Keywords
  8. Topics
  9. Schema
  10. Social Networks
  11. External Links
  12. Analytics And Tracking
  13. Libraries
  14. Hosting Providers
  15. CDN Services

We are analyzing https://www.nature.com/articles/s41467-020-15112-3.

Title:
Long noncoding RNA AGPG regulates PFKFB3-mediated tumor glycolytic reprogramming | Nature Communications
Description:
Tumor cells often reprogram their metabolism for rapid proliferation. The roles of long noncoding RNAs (lncRNAs) in metabolism remodeling and the underlying mechanisms remain elusive. Through screening, we found that the lncRNA Actin Gamma 1 Pseudogene (AGPG) is required for increased glycolysis activity and cell proliferation in esophageal squamous cell carcinoma (ESCC). Mechanistically, AGPG binds to and stabilizes 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3). By preventing APC/C-mediated ubiquitination, AGPG protects PFKFB3 from proteasomal degradation, leading to the accumulation of PFKFB3 in cancer cells, which subsequently activates glycolytic flux and promotes cell cycle progression. AGPG is also a transcriptional target of p53; loss or mutation of TP53 triggers the marked upregulation of AGPG. Notably, inhibiting AGPG dramatically impaired tumor growth in patient-derived xenograft (PDX) models. Clinically, AGPG is highly expressed in many cancers, and high AGPG expression levels are correlated with poor prognosis, suggesting that AGPG is a potential biomarker and cancer therapeutic target. PFKFB3 enhances glycolysis to promote cancer cell proliferation. Here, the authors identify a long noncoding RNA in esophageal squamous cell carcinoma, AGPG, which interacts with PFKFB3 and promotes its stability, leading to increased glycolysis and proliferation.
Website Age:
30 years and 10 months (reg. 1994-08-11).

Matching Content Categories {πŸ“š}

  • Education
  • Science
  • Telecommunications

Content Management System {πŸ“}

What CMS is nature.com built with?

Custom-built

No common CMS systems were detected on Nature.com, and no known web development framework was identified.

Traffic Estimate {πŸ“ˆ}

What is the average monthly size of nature.com audience?

πŸŒ† Monumental Traffic: 20M - 50M visitors per month


Based on our best estimate, this website will receive around 42,555,829 visitors per month in the current month.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Nature.com Make Money? {πŸ’Έ}


Display Ads {🎯}


The website utilizes display ads within its content to generate revenue. Check the next section for further revenue estimates.

Ads are managed by yourbow.com. Particular relationships are as follows:

Direct Advertisers (10)
google.com, pmc.com, doceree.com, yourbow.com, audienciad.com, onlinemediasolutions.com, advibe.media, aps.amazon.com, getmediamx.com, onomagic.com

Reseller Advertisers (38)
conversantmedia.com, rubiconproject.com, pubmatic.com, appnexus.com, openx.com, smartadserver.com, lijit.com, sharethrough.com, video.unrulymedia.com, google.com, yahoo.com, triplelift.com, onetag.com, sonobi.com, contextweb.com, 33across.com, indexexchange.com, media.net, themediagrid.com, adform.com, richaudience.com, sovrn.com, improvedigital.com, freewheel.tv, smaato.com, yieldmo.com, amxrtb.com, adyoulike.com, adpone.com, criteo.com, smilewanted.com, 152media.info, e-planning.net, smartyads.com, loopme.com, opera.com, mediafuse.com, betweendigital.com

How Much Does Nature.com Make? {πŸ’°}


Display Ads {🎯}

$536,300 per month
Estimations show Nature.com's display ad online revenue falls between $357,511 and $983,155 per month.

Keywords {πŸ”}

agpg, pfkfb, cell, fig, cells, expression, pubmed, cancer, article, escc, analysis, google, scholar, supplementary, cas, rna, assays, data, proliferation, performed, glycolysis, levels, kyse, nature, tumor, metabolism, central, china, tissues, knockdown, qpcr, showed, lncrnas, ubiquitination, cycle, abcam, binding, detection, test, sysucc, western, study, usa, high, glucose, significantly, independent, crispr, role, interaction,

Topics {βœ’οΈ}

plv-u6-agpg rna sgrna01-7sk-sgrna02-efs-hcas9-2a-puro rui-hua xuΒ &Β huai-qiang ju nature portfolio crispr/cas9 genome-editing system open-access database privacy policy fundamental research funds rui-hua xu advertising preventing apc/c-mediated ubiquitination anaphase-promoting complex apc/c21 apc/c-mediated cellular ubiquitylation huai-qiang ju degradation involving apc/c-cdh1 flag-tagged pfkfb3 wild-type p53-agpg-pfkfb3 axis leads research design sun yat-sen university reprints apc/c-mediated ubiquitination japan nature 493 nature 379 nature 509 nature 541 nature crispr/cas9-based strategy50 research small cell carcinoma robust transcriptome-wide discovery rna interference-based strategies thermo fisher scientific social media agpg-mediated cell proliferation p53-agpg-pfkfb3 axis cdna libraries ikk-nf-kappab pathway sirna library targeting amp-activated protein kinase vivo protein-rna interactions pcr primer acactaggccatgcaccaa/gcccacaggccaaattcattc k-rasg12v transformation leads vivo-optimized agpg inhibitor p53-mediated cellular response mcp-3flag plasmids led 13c-labeled metabolic intermediates flag-tagged pfkfb3 wt antibody-coated sepharose beads pcr primer gcaacaccacgaatcccaac/ttgtcccgctctggaaactc hypoxia-induced cisplatin resistance

Schema {πŸ—ΊοΈ}

WebPage:
      mainEntity:
         headline:Long noncoding RNA AGPG regulates PFKFB3-mediated tumor glycolytic reprogramming
         description:Tumor cells often reprogram their metabolism for rapid proliferation. The roles of long noncoding RNAs (lncRNAs) in metabolism remodeling and the underlying mechanisms remain elusive. Through screening, we found that the lncRNA Actin Gamma 1 Pseudogene (AGPG) is required for increased glycolysis activity and cell proliferation in esophageal squamous cell carcinoma (ESCC). Mechanistically, AGPG binds to and stabilizes 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3). By preventing APC/C-mediated ubiquitination, AGPG protects PFKFB3 from proteasomal degradation, leading to the accumulation of PFKFB3 in cancer cells, which subsequently activates glycolytic flux and promotes cell cycle progression. AGPG is also a transcriptional target of p53; loss or mutation of TP53 triggers the marked upregulation of AGPG. Notably, inhibiting AGPG dramatically impaired tumor growth in patient-derived xenograft (PDX) models. Clinically, AGPG is highly expressed in many cancers, and high AGPG expression levels are correlated with poor prognosis, suggesting that AGPG is a potential biomarker and cancer therapeutic target. PFKFB3 enhances glycolysis to promote cancer cell proliferation. Here, the authors identify a long noncoding RNA in esophageal squamous cell carcinoma, AGPG, which interacts with PFKFB3 and promotes its stability, leading to increased glycolysis and proliferation.
         datePublished:2020-03-20T00:00:00Z
         dateModified:2020-03-20T00:00:00Z
         pageStart:1
         pageEnd:16
         license:http://creativecommons.org/licenses/by/4.0/
         sameAs:https://doi.org/10.1038/s41467-020-15112-3
         keywords:
            Cancer
            Cancer metabolism
            Science
            Humanities and Social Sciences
            multidisciplinary
         image:
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig1_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig2_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig3_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig4_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig5_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig6_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig7_HTML.png
         isPartOf:
            name:Nature Communications
            issn:
               2041-1723
            volumeNumber:11
            type:
               Periodical
               PublicationVolume
         publisher:
            name:Nature Publishing Group UK
            logo:
               url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
               type:ImageObject
            type:Organization
         author:
               name:Jia Liu
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Ze-Xian Liu
               url:http://orcid.org/0000-0001-9698-0610
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Qi-Nian Wu
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Yun-Xin Lu
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Chau-Wei Wong
               affiliation:
                     name:The First Affiliated Hospital of Sun Yat-sen University
                     address:
                        name:The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Lei Miao
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Yun Wang
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Zixian Wang
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Ying Jin
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Ming-Ming He
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Chao Ren
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:De-Shen Wang
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Dong-Liang Chen
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Heng-Ying Pu
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Lin Feng
               url:http://orcid.org/0000-0001-6461-5838
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Bo Li
               url:http://orcid.org/0000-0002-7979-8339
               affiliation:
                     name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University
                     address:
                        name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Dan Xie
               url:http://orcid.org/0000-0003-2242-3138
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Mu-Sheng Zeng
               url:http://orcid.org/0000-0003-3509-5591
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Peng Huang
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Aifu Lin
               affiliation:
                     name:College of Life Sciences, Zhejiang University
                     address:
                        name:College of Life Sciences, Zhejiang University, Hangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Dongxin Lin
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Rui-Hua Xu
               url:http://orcid.org/0000-0001-9771-8534
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
                     name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
                     address:
                        name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               email:[email protected]
               type:Person
               name:Huai-Qiang Ju
               url:http://orcid.org/0000-0003-1713-5465
               affiliation:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                     address:
                        name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                        type:PostalAddress
                     type:Organization
                     name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
                     address:
                        name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
                        type:PostalAddress
                     type:Organization
               email:[email protected]
               type:Person
         isAccessibleForFree:1
         type:ScholarlyArticle
      context:https://schema.org
ScholarlyArticle:
      headline:Long noncoding RNA AGPG regulates PFKFB3-mediated tumor glycolytic reprogramming
      description:Tumor cells often reprogram their metabolism for rapid proliferation. The roles of long noncoding RNAs (lncRNAs) in metabolism remodeling and the underlying mechanisms remain elusive. Through screening, we found that the lncRNA Actin Gamma 1 Pseudogene (AGPG) is required for increased glycolysis activity and cell proliferation in esophageal squamous cell carcinoma (ESCC). Mechanistically, AGPG binds to and stabilizes 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3). By preventing APC/C-mediated ubiquitination, AGPG protects PFKFB3 from proteasomal degradation, leading to the accumulation of PFKFB3 in cancer cells, which subsequently activates glycolytic flux and promotes cell cycle progression. AGPG is also a transcriptional target of p53; loss or mutation of TP53 triggers the marked upregulation of AGPG. Notably, inhibiting AGPG dramatically impaired tumor growth in patient-derived xenograft (PDX) models. Clinically, AGPG is highly expressed in many cancers, and high AGPG expression levels are correlated with poor prognosis, suggesting that AGPG is a potential biomarker and cancer therapeutic target. PFKFB3 enhances glycolysis to promote cancer cell proliferation. Here, the authors identify a long noncoding RNA in esophageal squamous cell carcinoma, AGPG, which interacts with PFKFB3 and promotes its stability, leading to increased glycolysis and proliferation.
      datePublished:2020-03-20T00:00:00Z
      dateModified:2020-03-20T00:00:00Z
      pageStart:1
      pageEnd:16
      license:http://creativecommons.org/licenses/by/4.0/
      sameAs:https://doi.org/10.1038/s41467-020-15112-3
      keywords:
         Cancer
         Cancer metabolism
         Science
         Humanities and Social Sciences
         multidisciplinary
      image:
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig1_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig2_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig3_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig4_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig5_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig6_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-15112-3/MediaObjects/41467_2020_15112_Fig7_HTML.png
      isPartOf:
         name:Nature Communications
         issn:
            2041-1723
         volumeNumber:11
         type:
            Periodical
            PublicationVolume
      publisher:
         name:Nature Publishing Group UK
         logo:
            url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
            type:ImageObject
         type:Organization
      author:
            name:Jia Liu
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Ze-Xian Liu
            url:http://orcid.org/0000-0001-9698-0610
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Qi-Nian Wu
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Yun-Xin Lu
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Chau-Wei Wong
            affiliation:
                  name:The First Affiliated Hospital of Sun Yat-sen University
                  address:
                     name:The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Lei Miao
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Yun Wang
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Zixian Wang
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Ying Jin
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Ming-Ming He
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Chao Ren
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:De-Shen Wang
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Dong-Liang Chen
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Heng-Ying Pu
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Lin Feng
            url:http://orcid.org/0000-0001-6461-5838
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Bo Li
            url:http://orcid.org/0000-0002-7979-8339
            affiliation:
                  name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University
                  address:
                     name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Dan Xie
            url:http://orcid.org/0000-0003-2242-3138
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Mu-Sheng Zeng
            url:http://orcid.org/0000-0003-3509-5591
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Peng Huang
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Aifu Lin
            affiliation:
                  name:College of Life Sciences, Zhejiang University
                  address:
                     name:College of Life Sciences, Zhejiang University, Hangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Dongxin Lin
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Rui-Hua Xu
            url:http://orcid.org/0000-0001-9771-8534
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
                  name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
                  address:
                     name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            email:[email protected]
            type:Person
            name:Huai-Qiang Ju
            url:http://orcid.org/0000-0003-1713-5465
            affiliation:
                  name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
                  address:
                     name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
                     type:PostalAddress
                  type:Organization
                  name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
                  address:
                     name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
                     type:PostalAddress
                  type:Organization
            email:[email protected]
            type:Person
      isAccessibleForFree:1
["Periodical","PublicationVolume"]:
      name:Nature Communications
      issn:
         2041-1723
      volumeNumber:11
Organization:
      name:Nature Publishing Group UK
      logo:
         url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
         type:ImageObject
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:The First Affiliated Hospital of Sun Yat-sen University
      address:
         name:The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University
      address:
         name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:College of Life Sciences, Zhejiang University
      address:
         name:College of Life Sciences, Zhejiang University, Hangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
      address:
         name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
         type:PostalAddress
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
      address:
         name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
         type:PostalAddress
      name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
      address:
         name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
         type:PostalAddress
ImageObject:
      url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
Person:
      name:Jia Liu
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Ze-Xian Liu
      url:http://orcid.org/0000-0001-9698-0610
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Qi-Nian Wu
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Yun-Xin Lu
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Chau-Wei Wong
      affiliation:
            name:The First Affiliated Hospital of Sun Yat-sen University
            address:
               name:The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Lei Miao
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Yun Wang
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Zixian Wang
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Ying Jin
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Ming-Ming He
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Chao Ren
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:De-Shen Wang
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Dong-Liang Chen
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Heng-Ying Pu
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Lin Feng
      url:http://orcid.org/0000-0001-6461-5838
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Bo Li
      url:http://orcid.org/0000-0002-7979-8339
      affiliation:
            name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University
            address:
               name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Dan Xie
      url:http://orcid.org/0000-0003-2242-3138
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Mu-Sheng Zeng
      url:http://orcid.org/0000-0003-3509-5591
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Peng Huang
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Aifu Lin
      affiliation:
            name:College of Life Sciences, Zhejiang University
            address:
               name:College of Life Sciences, Zhejiang University, Hangzhou, China
               type:PostalAddress
            type:Organization
      name:Dongxin Lin
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
      name:Rui-Hua Xu
      url:http://orcid.org/0000-0001-9771-8534
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
            name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
            address:
               name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
               type:PostalAddress
            type:Organization
      email:[email protected]
      name:Huai-Qiang Ju
      url:http://orcid.org/0000-0003-1713-5465
      affiliation:
            name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center
            address:
               name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
               type:PostalAddress
            type:Organization
            name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences
            address:
               name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
               type:PostalAddress
            type:Organization
      email:[email protected]
PostalAddress:
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:Department of Biochemistry and Molecular Biology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:College of Life Sciences, Zhejiang University, Hangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China
      name:State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
      name:Precision Diagnosis and Treatment for Gastrointestinal Cancer, Chinese Academy of Medical Sciences, Guangzhou, China

External Links {πŸ”—}(278)

Analytics and Tracking {πŸ“Š}

  • Google Tag Manager

Libraries {πŸ“š}

  • Prism.js
  • Zoom.js

Emails and Hosting {βœ‰οΈ}

Mail Servers:

  • mxa-002c5801.gslb.pphosted.com
  • mxb-002c5801.gslb.pphosted.com

Name Servers:

  • pdns1.ultradns.net
  • pdns2.ultradns.net
  • pdns3.ultradns.org
  • pdns4.ultradns.org
  • pdns5.ultradns.info
  • pdns6.ultradns.co.uk

CDN Services {πŸ“¦}

  • Crossref

5.95s.