Here's how GITHUB.COM makes money* and how much!

*Please read our disclaimer before using our estimates.
Loading...

GITHUB . COM {}

Detected CMS Systems:

  1. Analyzed Page
  2. Matching Content Categories
  3. CMS
  4. Monthly Traffic Estimate
  5. How Does Github.com Make Money
  6. How Much Does Github.com Make
  7. Wordpress Themes And Plugins
  8. Keywords
  9. Topics
  10. Payment Methods
  11. Questions
  12. Schema
  13. External Links
  14. Analytics And Tracking
  15. Libraries
  16. Hosting Providers

We are analyzing https://github.com/marcelm/cutadapt/issues/616.

Title:
Statistics are incorrect when --nextseq-trim is combined with -q Β· Issue #616 Β· marcelm/cutadapt
Description:
cutadapt -q 15,0: Total basepairs processed: 218,527,840 bp Quality-trimmed: 7,116,934 bp (3.3%) Total written (filtered): 211,410,906 bp (96.7%) cutadapt --nextseq-trim=20: Total basepairs processed: 218,527,840 bp Quality-trimmed: 18,4...
Website Age:
17 years and 8 months (reg. 2007-10-09).

Matching Content Categories {πŸ“š}

  • Education
  • Cryptocurrency
  • Mobile Technology & AI

Content Management System {πŸ“}

What CMS is github.com built with?


Github.com relies on WORDPRESS.

Traffic Estimate {πŸ“ˆ}

What is the average monthly size of github.com audience?

πŸš€πŸŒ  Tremendous Traffic: 10M - 20M visitors per month


Based on our best estimate, this website will receive around 10,000,019 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Github.com Make Money? {πŸ’Έ}


Subscription Packages {πŸ’³}

We've located a dedicated page on github.com that might include details about subscription plans or recurring payments. We identified it based on the word pricing in one of its internal links. Below, you'll find additional estimates for its monthly recurring revenues.

How Much Does Github.com Make? {πŸ’°}


Subscription Packages {πŸ’³}

Prices on github.com are in US Dollars ($). They range from $4.00/month to $21.00/month.
We estimate that the site has approximately 4,989,889 paying customers.
The estimated monthly recurring revenue (MRR) is $20,957,532.
The estimated annual recurring revenues (ARR) are $251,490,385.

Wordpress Themes and Plugins {🎨}

What WordPress theme does this site use?

It is strange but we were not able to detect any theme on the page.

What WordPress plugins does this website use?

It is strange but we were not able to detect any plugins on the page.

Keywords {πŸ”}

read, total, adapter, error, cutadapt, time, nextseqtrim, statistics, qualitytrimmed, written, filtered, marcelm, issue, basepairs, processed, counts, outafqgz, errors, trimed, readsrfqgz, forestcat, runs, reply, sign, incorrect, closed, commented, test, sequential, testrunb, outbfqgz, numbers, report, trimmed, unexpected, anchored, correct, testrun, noindels, agatcggaagagcacacgtctgaactccagtca, agatcggaagagcgtcgtgtagggaaagagtgt, run, comment, problem, fixed, navigation, pull, requests, actions, security,

Topics {βœ’οΈ}

test-run-1b test-run-3b total basepairs processed sequential cutadapt runs personal information statistics pair-end data marcelm closed cutadapt --nextseq-trim=20 unexpected error counts reported error counts comment metadata assignees incorrect statistics appeared 840 bp quality-trimmed 250 bp quality-trimmed 137 bp quality-trimmed 396 bp quality-trimmed indels --nextseq-trim=10 test-run-2 test run closed issue forestcat1 edits correct statistics f908cbd sign test runs total written quality-trimmed sequential runs 5'- error counts total number nextseq-trim 0 --nextseq-trim=20 nextseq-trim=20 5' trimmed time 0-error 5'- adapter 1-error 3'- adapter 2-error 3'- adapter 3-error 3'- adapter open report refer cutadapt cutadapt 3 cutadapt 5'- anchored adapter vice versa anchored 5'- adapter trimed time removed sequences spent time chlige added assigned labels

Payment Methods {πŸ“Š}

  • Braintree

Questions {❓}

  • Already have an account?
  • Trimed time of 3-error 3'- adapter, respectively?

Schema {πŸ—ΊοΈ}

DiscussionForumPosting:
      context:https://schema.org
      headline:Statistics are incorrect when --nextseq-trim is combined with -q
      articleBody: `cutadapt -q 15,0`: ``` Total basepairs processed: 218,527,840 bp Quality-trimmed: 7,116,934 bp (3.3%) Total written (filtered): 211,410,906 bp (96.7%) ``` `cutadapt --nextseq-trim=20`: ``` Total basepairs processed: 218,527,840 bp Quality-trimmed: 18,457,253 bp (8.4%) Total written (filtered): 200,070,587 bp (91.6%) ``` `cutadapt -q 15,0 --nextseq-trim=20`: ``` Total basepairs processed: 218,527,840 bp Quality-trimmed: 2,155 bp (0.0%) Total written (filtered): 200,068,432 bp (91.6%) ``` See #615
      author:
         url:https://github.com/marcelm
         type:Person
         name:marcelm
      datePublished:2022-04-19T09:47:52.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:4
      url:https://github.com/616/cutadapt/issues/616
      context:https://schema.org
      headline:Statistics are incorrect when --nextseq-trim is combined with -q
      articleBody: `cutadapt -q 15,0`: ``` Total basepairs processed: 218,527,840 bp Quality-trimmed: 7,116,934 bp (3.3%) Total written (filtered): 211,410,906 bp (96.7%) ``` `cutadapt --nextseq-trim=20`: ``` Total basepairs processed: 218,527,840 bp Quality-trimmed: 18,457,253 bp (8.4%) Total written (filtered): 200,070,587 bp (91.6%) ``` `cutadapt -q 15,0 --nextseq-trim=20`: ``` Total basepairs processed: 218,527,840 bp Quality-trimmed: 2,155 bp (0.0%) Total written (filtered): 200,068,432 bp (91.6%) ``` See #615
      author:
         url:https://github.com/marcelm
         type:Person
         name:marcelm
      datePublished:2022-04-19T09:47:52.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:4
      url:https://github.com/616/cutadapt/issues/616
Person:
      url:https://github.com/marcelm
      name:marcelm
      url:https://github.com/marcelm
      name:marcelm
InteractionCounter:
      interactionType:https://schema.org/CommentAction
      userInteractionCount:4
      interactionType:https://schema.org/CommentAction
      userInteractionCount:4

Analytics and Tracking {πŸ“Š}

  • Site Verification - Google

Libraries {πŸ“š}

  • Clipboard.js
  • D3.js
  • Lodash

Emails and Hosting {βœ‰οΈ}

Mail Servers:

  • aspmx.l.google.com
  • alt1.aspmx.l.google.com
  • alt2.aspmx.l.google.com
  • alt3.aspmx.l.google.com
  • alt4.aspmx.l.google.com

Name Servers:

  • dns1.p08.nsone.net
  • dns2.p08.nsone.net
  • dns3.p08.nsone.net
  • dns4.p08.nsone.net
  • ns-1283.awsdns-32.org
  • ns-1707.awsdns-21.co.uk
  • ns-421.awsdns-52.com
  • ns-520.awsdns-01.net
8.4s.