GITHUB . COM {}

Matching Content Categories {📚}

• Mobile Technology & AI
• Video & Online Content
• Social Networks

Content Management System {📝}

What CMS is github.com built with?

Github.com is powered by WORDPRESS.

Traffic Estimate {📈}

What is the average monthly size of github.com audience?

🚀🌠 Tremendous Traffic: 10M - 20M visitors per month


Based on our best estimate, this website will receive around 10,000,019 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Github.com Make Money? {💸}

Subscription Packages {💳}

How Much Does Github.com Make? {💰}

Subscription Packages {💳}

Prices on github.com are in US Dollars ($). They range from $4.00/month to $21.00/month.
We estimate that the site has approximately 4,989,889 paying customers.
The estimated monthly recurring revenue (MRR) is $20,957,532.
The estimated annual recurring revenues (ARR) are $251,490,385.

Wordpress Themes and Plugins {🎨}

What WordPress theme does this site use?

It is strange but we were not able to detect any theme on the page.

What WordPress plugins does this website use?

It is strange but we were not able to detect any plugins on the page.

Keywords {🔍}

marcelm, alephreish, cutadapt, infofile, commented, sign, revcomp, issue, adapter, reads, reversecomplemented, bug, columns, read, sequence, author, info, file, added, navigation, pull, requests, actions, security, closed, problem, found, cat, testfna, test, testrv, testinfo, tatcagctcact, status, orientation, incorrect, reverse, complement, strand, flag, owner, shown, reference, react, github, labels, projects, milestone, footer, skip,

Topics {✒️}

203e21c marcelm closed cutadapt correctly identifies personal information bug reads/minute status sam/bam files personally totally happy comment metadata assignees opposite strand based reverse-complemented version identical reads differing extra flag column info test test_rv rc reverse-complemented sequence marcelm mentioned $ cat test cutadapt 3 tatcagctcact test info-file info-file info file fna bug reverse-complemented info --revcomp reverse complement wrong strand issue head -n1 substrings extracted principle usable false positives input reads plainly unreliable 5' quality trimming prefix removal potentially truncated assigned labels labels projects projects milestone milestone relationships 0 µs/read adapter added github read read incorrect sequence revcomp flag reads

Payment Methods {📊}

• Braintree

Questions {❓}

• Already have an account?
• Any objections?

Schema {🗺️}

DiscussionForumPosting:
      context:https://schema.org
      headline:Bug in --info-file with --revcomp
      articleBody: $ cutadapt 2>&1 | head -n1 This is cutadapt 3.3 with Python 3.8.5 It seems that there is a problem with the `--info-file` when the adapter is found in `revcomp`: $ cat test.fna >test TATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG >test_rv CGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATA $ $ cutadapt --report=minimal --info-file test.info --revcomp -g TATCAGCTCACT test.fna -o /dev/null [8<----------] 00:00:00 2 reads @ 237.0 µs/read; 0.25 M reads/minute status in_reads in_bp too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp OK 2 200 0 0 0 2 2 0 176 $ $ cat test.info test 0 0 12 TATCAGCTCACT CAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG 1 test_rv rc 0 0 12 CGGTTCCTGGCC TTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATA 1 Above, there are two identical reads differing in orientation. `cutadapt` correctly identifies the adapter in both, but in `info-file` the sequences in columns 5-7 are incorrect for the read with a match in the reverse complement, as they contain substrings extracted from the wrong strand. The coordinates in columns 3-4 are in principle usable as they can be understood by a parser as referring to the opposite strand based on the flag " rc" (although false positives can emerge if input reads for some other reason already have this very string "rc" in the definition, e.g. `>my-read read with rc`), but columns 5-7 are plainly unreliable.
      author:
         url:https://github.com/alephreish
         type:Person
         name:alephreish
      datePublished:2021-03-10T12:36:22.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:5
      url:https://github.com/517/cutadapt/issues/517
      context:https://schema.org
      headline:Bug in --info-file with --revcomp
      articleBody: $ cutadapt 2>&1 | head -n1 This is cutadapt 3.3 with Python 3.8.5 It seems that there is a problem with the `--info-file` when the adapter is found in `revcomp`: $ cat test.fna >test TATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG >test_rv CGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATA $ $ cutadapt --report=minimal --info-file test.info --revcomp -g TATCAGCTCACT test.fna -o /dev/null [8<----------] 00:00:00 2 reads @ 237.0 µs/read; 0.25 M reads/minute status in_reads in_bp too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp OK 2 200 0 0 0 2 2 0 176 $ $ cat test.info test 0 0 12 TATCAGCTCACT CAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG 1 test_rv rc 0 0 12 CGGTTCCTGGCC TTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATA 1 Above, there are two identical reads differing in orientation. `cutadapt` correctly identifies the adapter in both, but in `info-file` the sequences in columns 5-7 are incorrect for the read with a match in the reverse complement, as they contain substrings extracted from the wrong strand. The coordinates in columns 3-4 are in principle usable as they can be understood by a parser as referring to the opposite strand based on the flag " rc" (although false positives can emerge if input reads for some other reason already have this very string "rc" in the definition, e.g. `>my-read read with rc`), but columns 5-7 are plainly unreliable.
      author:
         url:https://github.com/alephreish
         type:Person
         name:alephreish
      datePublished:2021-03-10T12:36:22.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:5
      url:https://github.com/517/cutadapt/issues/517
Person:
      url:https://github.com/alephreish
      name:alephreish
      url:https://github.com/alephreish
      name:alephreish
InteractionCounter:
      interactionType:https://schema.org/CommentAction
      userInteractionCount:5
      interactionType:https://schema.org/CommentAction
      userInteractionCount:5

External Links {🔗}(3)

• What is the monthly revenue of https://github.blog?
• How much income does https://www.pnas.org/content/104/11/4618 have?
• What's the monthly money flow for https://www.githubstatus.com/?

Analytics and Tracking {📊}

• Site Verification - Google

Libraries {📚}

• Clipboard.js
• D3.js
• Lodash

Emails and Hosting {✉️}

Mail Servers:

• aspmx.l.google.com
• alt1.aspmx.l.google.com
• alt2.aspmx.l.google.com
• alt3.aspmx.l.google.com
• alt4.aspmx.l.google.com

Name Servers:

• dns1.p08.nsone.net
• dns2.p08.nsone.net
• dns3.p08.nsone.net
• dns4.p08.nsone.net
• ns-1283.awsdns-32.org
• ns-1707.awsdns-21.co.uk
• ns-421.awsdns-52.com
• ns-520.awsdns-01.net