GITHUB . COM {}

Matching Content Categories {📚}

• Video & Online Content
• Social Networks
• Dating & Relationships

Content Management System {📝}

What CMS is github.com built with?

Github.com utilizes WORDPRESS.

Traffic Estimate {📈}

What is the average monthly size of github.com audience?

🚀🌠 Tremendous Traffic: 10M - 20M visitors per month


Based on our best estimate, this website will receive around 10,000,019 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Github.com Make Money? {💸}

Subscription Packages {💳}

How Much Does Github.com Make? {💰}

Subscription Packages {💳}

Prices on github.com are in US Dollars ($). They range from $4.00/month to $21.00/month.
We estimate that the site has approximately 4,989,889 paying customers.
The estimated monthly recurring revenue (MRR) is $20,957,532.
The estimated annual recurring revenues (ARR) are $251,490,385.

Wordpress Themes and Plugins {🎨}

What WordPress theme does this site use?

It is strange but we were not able to detect any theme on the page.

What WordPress plugins does this website use?

It is strange but we were not able to detect any plugins on the page.

Keywords {🔍}

read, sign, marcelm, cutadapt, status, issue, file, info, reversecomplement, infofile, original, modified, version, navigation, pull, requests, actions, security, unavailable, closed, revcomp, docs, reversecomplemented, true, grep, mctdwt, aggaaagggataaaagaggaggtgaaaaaaatgaggatagcagcagaaatgtagagaaaaaatgtgacagaaggggaggaaagaggagagaatagaggaaaggaggaagtagaagaaaaaggaagagaaataggttggaaagagtaaaaaggaaaagagaaagatgatgagagaacaagaaggataaaaatggggttagaacaggaagtaaagagatgaagaggaaaaagaaagagagagggagtaaaaaaggtggaagaggaggtgaagaaaagagagaaagcagggagagagaag, python, dad, github, labels, projects, milestone, footer, skip, content, menu, product, solutions, resources, open, source, enterprise, pricing, search, jump, public, notifications, fork, star,

Topics {✒️}

reverse-complement status reverse-complemented read output sequence file comment metadata assignees reverse-complemented original read id info file docs 29d4ad8 sign info m01549 modified read cutadapt 1602 cutadapt makes sense ve fixed chlige added assigned labels labels projects projects milestone milestone relationships github read aggaaagggataaaagaggaggtgaaaaaaatgaggatagcagcagaaatgtagagaaaaaatgtgacagaaggggaggaaagaggagagaatagaggaaaggaggaagtagaagaaaaaggaagagaaataggttggaaagagtaaaaaggaaaagagaaagatgatgagagaacaagaaggataaaaatggggttagaacaggaagtaaagagatgaagaggaaaaagaaagagagagggagtaaaaaaggtggaagaggaggtgaagaaaagagagaaagcagggagagagaag rc original sign skip jump run revcomp changed adding space true include sufficient illustration problem revcomp 000000000-ctdwt gaca h1780 a9 finding shown agree commit references suffix appearing

Payment Methods {📊}

• Braintree

Questions {❓}

• Already have an account?
• Is it possible to include the reverse-complement status in the info file?

Schema {🗺️}

DiscussionForumPosting:
      context:https://schema.org
      headline:reverse-complement status unavailable in --info-file
      articleBody:When cutadapt is run with `--revcomp`, the docs say that "The name of a reverse-complemented read is changed by adding a space and `rc` to it." Although this is true in the output sequence file, it is not true in the info file, which uses the original read id and thus does not indicate that the read has been reverse-complemented. Is it possible to include the reverse-complement status in the info file? It would be sufficient to use the modified read name instead of the original. Illustration of the problem: ``` $ grep -A1 1101:22355:1602 cutadapt.revcomp.fq @M01549:302:000000000-CTDWT:1:1101:22355:1602 2:N:0:2 rc AGGAAAGGGATAAAAGAGGAGGTGAAAAAAATGAGGATAGCAGCAGAAATGTAGAGAAAAAATGTGACAGAAGGGGAGGAAAGAGGAGAGAATAGAGGAAAGGAGGAAGTAGAAGAAAAAGGAAGAGAAATAGGTTGGAAAGAGTAAAAAGGAAAAGAGAAAGATGATGAGAGAACAAGAAGGATAAAAATGGGGTTAGAACAGGAAGTAAAGAGATGAAGAGGAAAAAGAAAGAGAGAGGGAGTAAAAAAGGTGGAAGAGGAGGTGAAGAAAAGAGAGAAAGCAGGGAGAGAGAAG $ grep 1101:22355:1602 cutadapt.revcomp.info M01549:302:000000000-CTDWT:1:1101:22355:1602 2:N:0:2 0 0 4 GACA AGGAAAGGGATAAAAGAGGAGGTGAAAAAAATGAGGATAGCAGCAGAAATGTAGAGAAAAAATGTGACAGAAGGGGAGGAAAGAGGAGAGAATAGAGGAAAGGAGGAAGTAGAAGAAAAAGGAAGAGAAATAGGTTGGAAAGAGTAAAAAGGAAAAGAGAAAGATGATGAGAGAACAAGAAGGATAAAAATGGGGTTAGAACAGGAAGTAAAGAGATGAAGAGGAAAAAGAAAGAGAGAGGGAGTAAAAAAGGTGGAAGAGGAGGTGAAGAAAAGAGAGAAAGCAGGGAGAGAGAAG H1780 **** ***)*).*10*/91/((()*.*+./*14++*+**)*+1**)++*++;51*3*+++*1*0+2*++*+**=:11*3,=1+C;,3*,6*=736@,,+4,4+46,,6+,,,,,+9,,,9+,4,,49,,944,,9,,+,,,,,9,,,,9,,94,,4,,,,94,,A,49,,,,,,,A9,:,,,,?9,,99,5,,,9,,::9,,,,,6,5,,,6:,,<,9,,,,,9966,,,,,,,@C66,;,;6,,,<,;,+;,,;,,6,6;,<;,,6,6;,,,,6,,,-,,<--6,,,,;,,6;,6-,,,,6 ``` Version info follows: ``` $ cutadapt --version 2.8 $ python3 --version Python 3.6.8 $ # installed cutadapt via pip $ # ran with --revcomp and --info-file ```
      author:
         url:https://github.com/elmccarthy
         type:Person
         name:elmccarthy
      datePublished:2020-02-07T08:20:03.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:1
      url:https://github.com/438/cutadapt/issues/438
      context:https://schema.org
      headline:reverse-complement status unavailable in --info-file
      articleBody:When cutadapt is run with `--revcomp`, the docs say that "The name of a reverse-complemented read is changed by adding a space and `rc` to it." Although this is true in the output sequence file, it is not true in the info file, which uses the original read id and thus does not indicate that the read has been reverse-complemented. Is it possible to include the reverse-complement status in the info file? It would be sufficient to use the modified read name instead of the original. Illustration of the problem: ``` $ grep -A1 1101:22355:1602 cutadapt.revcomp.fq @M01549:302:000000000-CTDWT:1:1101:22355:1602 2:N:0:2 rc AGGAAAGGGATAAAAGAGGAGGTGAAAAAAATGAGGATAGCAGCAGAAATGTAGAGAAAAAATGTGACAGAAGGGGAGGAAAGAGGAGAGAATAGAGGAAAGGAGGAAGTAGAAGAAAAAGGAAGAGAAATAGGTTGGAAAGAGTAAAAAGGAAAAGAGAAAGATGATGAGAGAACAAGAAGGATAAAAATGGGGTTAGAACAGGAAGTAAAGAGATGAAGAGGAAAAAGAAAGAGAGAGGGAGTAAAAAAGGTGGAAGAGGAGGTGAAGAAAAGAGAGAAAGCAGGGAGAGAGAAG $ grep 1101:22355:1602 cutadapt.revcomp.info M01549:302:000000000-CTDWT:1:1101:22355:1602 2:N:0:2 0 0 4 GACA AGGAAAGGGATAAAAGAGGAGGTGAAAAAAATGAGGATAGCAGCAGAAATGTAGAGAAAAAATGTGACAGAAGGGGAGGAAAGAGGAGAGAATAGAGGAAAGGAGGAAGTAGAAGAAAAAGGAAGAGAAATAGGTTGGAAAGAGTAAAAAGGAAAAGAGAAAGATGATGAGAGAACAAGAAGGATAAAAATGGGGTTAGAACAGGAAGTAAAGAGATGAAGAGGAAAAAGAAAGAGAGAGGGAGTAAAAAAGGTGGAAGAGGAGGTGAAGAAAAGAGAGAAAGCAGGGAGAGAGAAG H1780 **** ***)*).*10*/91/((()*.*+./*14++*+**)*+1**)++*++;51*3*+++*1*0+2*++*+**=:11*3,=1+C;,3*,6*=736@,,+4,4+46,,6+,,,,,+9,,,9+,4,,49,,944,,9,,+,,,,,9,,,,9,,94,,4,,,,94,,A,49,,,,,,,A9,:,,,,?9,,99,5,,,9,,::9,,,,,6,5,,,6:,,<,9,,,,,9966,,,,,,,@C66,;,;6,,,<,;,+;,,;,,6,6;,<;,,6,6;,,,,6,,,-,,<--6,,,,;,,6;,6-,,,,6 ``` Version info follows: ``` $ cutadapt --version 2.8 $ python3 --version Python 3.6.8 $ # installed cutadapt via pip $ # ran with --revcomp and --info-file ```
      author:
         url:https://github.com/elmccarthy
         type:Person
         name:elmccarthy
      datePublished:2020-02-07T08:20:03.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:1
      url:https://github.com/438/cutadapt/issues/438
Person:
      url:https://github.com/elmccarthy
      name:elmccarthy
      url:https://github.com/elmccarthy
      name:elmccarthy
InteractionCounter:
      interactionType:https://schema.org/CommentAction
      userInteractionCount:1
      interactionType:https://schema.org/CommentAction
      userInteractionCount:1

External Links {🔗}(2)

• How profitable is https://github.blog?
• How much money does https://www.githubstatus.com/ make?

Analytics and Tracking {📊}

• Site Verification - Google

Libraries {📚}

• Clipboard.js
• D3.js
• Lodash

Emails and Hosting {✉️}

Mail Servers:

• aspmx.l.google.com
• alt1.aspmx.l.google.com
• alt2.aspmx.l.google.com
• alt3.aspmx.l.google.com
• alt4.aspmx.l.google.com

Name Servers:

• dns1.p08.nsone.net
• dns2.p08.nsone.net
• dns3.p08.nsone.net
• dns4.p08.nsone.net
• ns-1283.awsdns-32.org
• ns-1707.awsdns-21.co.uk
• ns-421.awsdns-52.com
• ns-520.awsdns-01.net