GITHUB . COM {}

Matching Content Categories {📚}

• Mobile Technology & AI
• Video & Online Content
• Technology & Computing

Content Management System {📝}

What CMS is github.com built with?

Github.com is based on WORDPRESS.

Traffic Estimate {📈}

What is the average monthly size of github.com audience?

🚀🌠 Tremendous Traffic: 10M - 20M visitors per month


Based on our best estimate, this website will receive around 10,000,019 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Github.com Make Money? {💸}

Subscription Packages {💳}

How Much Does Github.com Make? {💰}

Subscription Packages {💳}

Prices on github.com are in US Dollars ($). They range from $4.00/month to $21.00/month.
We estimate that the site has approximately 4,989,889 paying customers.
The estimated monthly recurring revenue (MRR) is $20,957,532.
The estimated annual recurring revenues (ARR) are $251,490,385.

Wordpress Themes and Plugins {🎨}

What WordPress theme does this site use?

It is strange but we were not able to detect any theme on the page.

What WordPress plugins does this website use?

It is strange but we were not able to detect any plugins on the page.

Keywords {🔍}

adapter, trimmed, marcelm, cutadapt, linked, end, issue, noindels, reads, sign, read, behavior, pair, dmelu, tempfq, option, adapters, allowed, errors, error, cgggcaggctatgttttctttctactggatcagatcggaagagcgtcgtgtagggaaagagtgt, total, length, navigation, source, code, pull, requests, actions, security, incorrectly, closed, command, bases, correct, rate, bug, readsminute, processed, written, times, overview, removed, sequences, count, expect, maxerr, counts, commented, github,

Topics {✒️}

source code total basepairs processed marcelm closed comment metadata assignees command-line options fq processing reads cat ~/tmp/temp1 error counts 29 single-end mode reads/minute reads written 10% error rate command trims file temp1 cutadapt 2 left unchanged allowed errors passing filters removed sequences ve fixed email author assigned labels labels projects projects milestone milestone relationships personal information agatcggaagagcgtcgtgtagggaaagagtgt' temp1 agatcggaagagcgtcgtgtagggaaagagtgt temp1 observed behavior weird behavior 2 µs/read incorrectly trimmed github linked pair linked adapters issue 5' end length 3' end length correct behavior trimmed adapter 1 reads fq linked behavior 5' end pair read 3' end option option

Payment Methods {📊}

• Braintree

Questions {❓}

• Already have an account?

Schema {🗺️}

DiscussionForumPosting:
      context:https://schema.org
      headline:first adapter in linked pair is incorrectly trimmed from 5' end of read
      articleBody:Using `cutadapt` 2.1 compiled from source code, the below command trims the first adapter of the specified liked pair from the read in file `temp1.fq`. This behavior seems incorrect because many bases are mismatched near the 3' end of the trimmed adapter. The correct behavior should be that the read is left unchanged. Also, the last two bases of the adapter are not trimmed. The observed behavior would be correct if option `--no-indels` was **not** specified. So the issue seems to be that `cutadapt` ignores option `--no-indels` when searching for linked adapters. Another weird behavior is that the numbers of allowed errors are calculate using a 10% error rate, instead of the 20% rate specified by option `-e`. ```bash cat ~/tmp/temp1.fq ``` ``` @bug CGGGCAGGCTATGTTTTCTTCTGCTGGACCCTTTCATACCTGCTTCCACTCTGACCTCCACATAAATTCCACCAGCGAGTTTCAGCTTTTTTGCCCAATTC + AAAAFJJ7JFFFJJJJJJJJJJJJJJJJJJAJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJFJ-FJ<AJ)A7)7FJAFFAFJJJJJFJAA<FJ< ``` ```bash cutadapt --no-indels -e 0.2 -y ' {name}' -a '3=^CGGGCAGGCTATGTTTTCTTTCTACTGGATC...AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' temp1.fq ``` ``` This is cutadapt 2.1 with Python 3.7.2 Command line parameters: --no-indels -e 0.2 -y {name} -a 3=^CGGGCAGGCTATGTTTTCTTTCTACTGGATC...AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT temp1.fq Processing reads on 1 core in single-end mode ... [8<----------] 00:00:00 1 reads @ 1153.2 µs/read; 0.05 M reads/minute @bug 3 CCTTTCATACCTGCTTCCACTCTGACCTCCACATAAATTCCACCAGCGAGTTTCAGCTTTTTTGCCCAATTC + JAJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJFJ-FJ<AJ)A7)7FJAFFAFJJJJJFJAA<FJ< Finished in 0.00 s (3591 us/read; 0.02 M reads/minute). === Summary === Total reads processed: 1 Reads with adapters: 1 (100.0%) Reads written (passing filters): 1 (100.0%) Total basepairs processed: 101 bp Total written (filtered): 72 bp (71.3%) === Adapter 1 === Sequence: CGGGCAGGCTATGTTTTCTTTCTACTGGATC...AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; Type: linked; Length: 31+33; 5' trimmed: 1 times; 3' trimmed: 0 times No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-31 bp: 3 No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3 Overview of removed sequences at 5' end length count expect max.err error counts 29 1 0.0 2 0 0 0 1 Overview of removed sequences at 3' end length count expect max.err error counts ```
      author:
         url:https://github.com/dmelu
         type:Person
         name:dmelu
      datePublished:2019-08-10T01:46:18.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:2
      url:https://github.com/394/cutadapt/issues/394
      context:https://schema.org
      headline:first adapter in linked pair is incorrectly trimmed from 5' end of read
      articleBody:Using `cutadapt` 2.1 compiled from source code, the below command trims the first adapter of the specified liked pair from the read in file `temp1.fq`. This behavior seems incorrect because many bases are mismatched near the 3' end of the trimmed adapter. The correct behavior should be that the read is left unchanged. Also, the last two bases of the adapter are not trimmed. The observed behavior would be correct if option `--no-indels` was **not** specified. So the issue seems to be that `cutadapt` ignores option `--no-indels` when searching for linked adapters. Another weird behavior is that the numbers of allowed errors are calculate using a 10% error rate, instead of the 20% rate specified by option `-e`. ```bash cat ~/tmp/temp1.fq ``` ``` @bug CGGGCAGGCTATGTTTTCTTCTGCTGGACCCTTTCATACCTGCTTCCACTCTGACCTCCACATAAATTCCACCAGCGAGTTTCAGCTTTTTTGCCCAATTC + AAAAFJJ7JFFFJJJJJJJJJJJJJJJJJJAJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJFJ-FJ<AJ)A7)7FJAFFAFJJJJJFJAA<FJ< ``` ```bash cutadapt --no-indels -e 0.2 -y ' {name}' -a '3=^CGGGCAGGCTATGTTTTCTTTCTACTGGATC...AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' temp1.fq ``` ``` This is cutadapt 2.1 with Python 3.7.2 Command line parameters: --no-indels -e 0.2 -y {name} -a 3=^CGGGCAGGCTATGTTTTCTTTCTACTGGATC...AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT temp1.fq Processing reads on 1 core in single-end mode ... [8<----------] 00:00:00 1 reads @ 1153.2 µs/read; 0.05 M reads/minute @bug 3 CCTTTCATACCTGCTTCCACTCTGACCTCCACATAAATTCCACCAGCGAGTTTCAGCTTTTTTGCCCAATTC + JAJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJFJ-FJ<AJ)A7)7FJAFFAFJJJJJFJAA<FJ< Finished in 0.00 s (3591 us/read; 0.02 M reads/minute). === Summary === Total reads processed: 1 Reads with adapters: 1 (100.0%) Reads written (passing filters): 1 (100.0%) Total basepairs processed: 101 bp Total written (filtered): 72 bp (71.3%) === Adapter 1 === Sequence: CGGGCAGGCTATGTTTTCTTTCTACTGGATC...AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; Type: linked; Length: 31+33; 5' trimmed: 1 times; 3' trimmed: 0 times No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-31 bp: 3 No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3 Overview of removed sequences at 5' end length count expect max.err error counts 29 1 0.0 2 0 0 0 1 Overview of removed sequences at 3' end length count expect max.err error counts ```
      author:
         url:https://github.com/dmelu
         type:Person
         name:dmelu
      datePublished:2019-08-10T01:46:18.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:2
      url:https://github.com/394/cutadapt/issues/394
Person:
      url:https://github.com/dmelu
      name:dmelu
      url:https://github.com/dmelu
      name:dmelu
InteractionCounter:
      interactionType:https://schema.org/CommentAction
      userInteractionCount:2
      interactionType:https://schema.org/CommentAction
      userInteractionCount:2

External Links {🔗}(2)

• Earnings of https://github.blog
• https://www.githubstatus.com/ income

Analytics and Tracking {📊}

• Site Verification - Google

Libraries {📚}

• Clipboard.js
• D3.js
• Lodash

Emails and Hosting {✉️}

Mail Servers:

• aspmx.l.google.com
• alt1.aspmx.l.google.com
• alt2.aspmx.l.google.com
• alt3.aspmx.l.google.com
• alt4.aspmx.l.google.com

Name Servers:

• dns1.p08.nsone.net
• dns2.p08.nsone.net
• dns3.p08.nsone.net
• dns4.p08.nsone.net
• ns-1283.awsdns-32.org
• ns-1707.awsdns-21.co.uk
• ns-421.awsdns-52.com
• ns-520.awsdns-01.net