GITHUB . COM {}

Matching Content Categories {📚}

• Real Estate
• Cryptocurrency
• Mobile Technology & AI

Content Management System {📝}

What CMS is github.com built with?

Github.com is based on WORDPRESS.

Traffic Estimate {📈}

What is the average monthly size of github.com audience?

🚀🌠 Tremendous Traffic: 10M - 20M visitors per month


Based on our best estimate, this website will receive around 10,000,019 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Github.com Make Money? {💸}

Subscription Packages {💳}

How Much Does Github.com Make? {💰}

Subscription Packages {💳}

Prices on github.com are in US Dollars ($). They range from $4.00/month to $21.00/month.
We estimate that the site has approximately 4,989,889 paying customers.
The estimated monthly recurring revenue (MRR) is $20,957,532.
The estimated annual recurring revenues (ARR) are $251,490,385.

Wordpress Themes and Plugins {🎨}

What WordPress theme does this site use?

It is strange but we were not able to detect any theme on the page.

What WordPress plugins does this website use?

It is strange but we were not able to detect any plugins on the page.

Keywords {🔍}

reads, untrimmed, marcelm, option, short, pair, adaptor, mode, options, cutadapt, legacy, sign, issue, trimmed, pairfilterany, rshortfastq, rnoltrfastq, trimming, commented, read, pairs, parsing, gcorre, pairedend, filtering, works, output, file, adapter, owner, pairfilterboth, checks, pairfilter, account, provided, navigation, open, pull, requests, actions, security, tooshortread, closed, tooshort, separate, files, longer, command, line, untrimmedpairedoutput,

Topics {✒️}

gtctgttgtgtgactctggtaac --untrimmed-paired-output r2_noltr processing paired-end reads paired-end legacy mode short-paired-output r2_short issue open paired-end mode short-read option parsing fastq --untrimmed-output r1_noltr marcelm closed min/max size output r1/r2 pairs separate output files untrimmed output file comment metadata assignees discarding reads based independent filtering options short-output r1_short untrimmed-output options parse short reads pair-filter settings default --pair-filter= legacy mode works short essentially checks filtering short reads marcelm mentioned pair-filter setting pair-filter option running cutadapt trimmed r1 reads parsing error legacy mode log file separate files short options read pair filtering criteria 35 --pair-filter= pair-filter= discard-untrimmed command line makes sense computing time adjust behavior introduce behavior finally fixed primer mismatch assigned labels labels projects projects milestone milestone relationships

Payment Methods {📊}

• Braintree

Questions {❓}

• Already have an account?
• Is there an option I missed or is there a parsing error when using those options?

Schema {🗺️}

DiscussionForumPosting:
      context:https://schema.org
      headline:too-short-read option parsing all reads to untrimmed
      articleBody:Dear all, I'm processing paired-end reads to remove adaptor in R1 and filtering short reads. When using only -m, the legacy mode works well but when adding the --too-short options to parse short reads in separate output files, the legacy mode is no longer active and all the reads (containing the adaptor or not) go to the untrimmed output file but are actually trimmed. Command line: > cutadapt -O 23 -e 0.1-m 35 --pair-filter=any --too-short-output R1_short.fastq --too-short-paired-output R2_short.fastq --no-indels -g GTCTGTTGTGTGACTCTGGTAAC --untrimmed-paired-output R2_noLTR.fastq --untrimmed-output R1_noLTR.fastq -o R1_LTR.fastq -p R2_LTR.fastq pair1.fastq pair2.fastq log file with -m only : > Trimming 1 adapter with at most 10.0% errors in paired-end legacy mode ... log file with --too-short options: > Trimming 1 adapter with at most 10.0% errors in paired-end mode ... Is there an option I missed or is there a parsing error when using those options? cutadapt 1.14 with Python 3.5.2/debian Best,
      author:
         url:https://github.com/gcorre
         type:Person
         name:gcorre
      datePublished:2017-09-01T15:11:09.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:4
      url:https://github.com/257/cutadapt/issues/257
      context:https://schema.org
      headline:too-short-read option parsing all reads to untrimmed
      articleBody:Dear all, I'm processing paired-end reads to remove adaptor in R1 and filtering short reads. When using only -m, the legacy mode works well but when adding the --too-short options to parse short reads in separate output files, the legacy mode is no longer active and all the reads (containing the adaptor or not) go to the untrimmed output file but are actually trimmed. Command line: > cutadapt -O 23 -e 0.1-m 35 --pair-filter=any --too-short-output R1_short.fastq --too-short-paired-output R2_short.fastq --no-indels -g GTCTGTTGTGTGACTCTGGTAAC --untrimmed-paired-output R2_noLTR.fastq --untrimmed-output R1_noLTR.fastq -o R1_LTR.fastq -p R2_LTR.fastq pair1.fastq pair2.fastq log file with -m only : > Trimming 1 adapter with at most 10.0% errors in paired-end legacy mode ... log file with --too-short options: > Trimming 1 adapter with at most 10.0% errors in paired-end mode ... Is there an option I missed or is there a parsing error when using those options? cutadapt 1.14 with Python 3.5.2/debian Best,
      author:
         url:https://github.com/gcorre
         type:Person
         name:gcorre
      datePublished:2017-09-01T15:11:09.000Z
      interactionStatistic:
         type:InteractionCounter
         interactionType:https://schema.org/CommentAction
         userInteractionCount:4
      url:https://github.com/257/cutadapt/issues/257
Person:
      url:https://github.com/gcorre
      name:gcorre
      url:https://github.com/gcorre
      name:gcorre
InteractionCounter:
      interactionType:https://schema.org/CommentAction
      userInteractionCount:4
      interactionType:https://schema.org/CommentAction
      userInteractionCount:4

External Links {🔗}(2)

• How much profit does https://github.blog generate?
• How much does https://www.githubstatus.com/ bring in each month?

Analytics and Tracking {📊}

• Site Verification - Google

Libraries {📚}

• Clipboard.js
• D3.js
• Lodash

Emails and Hosting {✉️}

Mail Servers:

• aspmx.l.google.com
• alt1.aspmx.l.google.com
• alt2.aspmx.l.google.com
• alt3.aspmx.l.google.com
• alt4.aspmx.l.google.com

Name Servers:

• dns1.p08.nsone.net
• dns2.p08.nsone.net
• dns3.p08.nsone.net
• dns4.p08.nsone.net
• ns-1283.awsdns-32.org
• ns-1707.awsdns-21.co.uk
• ns-421.awsdns-52.com
• ns-520.awsdns-01.net