Here's how NCBI.NLM.NIH.GOV makes money* and how much!

*Please read our disclaimer before using our estimates.
Loading...

NCBI . NLM . NIH . GOV {}

  1. Analyzed Page
  2. Matching Content Categories
  3. CMS
  4. Monthly Traffic Estimate
  5. How Does Ncbi.nlm.nih.gov Make Money
  6. Keywords
  7. Topics
  8. Social Networks
  9. External Links
  10. Analytics And Tracking
  11. Libraries
  12. Hosting Providers
  13. CDN Services

We began analyzing https://pmc.ncbi.nlm.nih.gov/articles/PMC5305241/, but it redirected us to https://pmc.ncbi.nlm.nih.gov/articles/PMC5305241/. The analysis below is for the second page.

Title[redir]:
Development, identification and validation of CAPS marker for SHELL trait which governs dura, pisifera and tenera fruit forms in oil palm (Elaeis guineensis Jacq.) - PMC
Description:
The oil palm fruit forms (dura, pisifera and tenera) governed by the shell thickness gene (Sh) plays a major role in identification of fruit type and also influences palm oil yield. Identification of desired fruit type is a major asset to the ...

Matching Content Categories {šŸ“š}

  • Education
  • Environment
  • News & Politics

Content Management System {šŸ“}

What CMS is ncbi.nlm.nih.gov built with?

Custom-built

No common CMS systems were detected on Ncbi.nlm.nih.gov, and no known web development framework was identified.

Traffic Estimate {šŸ“ˆ}

What is the average monthly size of ncbi.nlm.nih.gov audience?

🌠 Phenomenal Traffic: 5M - 10M visitors per month


Based on our best estimate, this website will receive around 5,000,019 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Ncbi.nlm.nih.gov Make Money? {šŸ’ø}

The income method remains a mystery to us.

Not every website is profit-driven; some are created to spread information or serve as an online presence. Websites can be made for many reasons. This could be one of them. Ncbi.nlm.nih.gov could be getting rich in stealth mode, or the way it's monetizing isn't detectable.

Keywords {šŸ”}

oil, pisifera, palm, dura, genotypes, tenera, fruit, shell, sequences, marker, markers, study, gene, identification, analysis, nucleotide, present, identified, transcription, fig, factor, sequence, google, scholar, allele, mapping, dna, bunch, data, qtls, caps, ssr, snp, obtained, forms, results, found, spsc, guineensis, form, primer, alleles, traits, mads, box, restriction, pmc, doi, cross, association,

Topics {āœ’ļø}

f5’atggtcccgtcctaggattt3’r5’aacagcttgcctccttggta3’ oil/ bunch f5’tttggacttgtccatcctcc3’ r5’tctagctgccaaaagcttgc3’ kernel/fruit f5’atggtcccgtcctaggattt3’ r5’aacagcttgcctccttggta3’ fruit/bunch f5’aaggagaactaccacgcgaa3’r5’aattatgtgcggttgttgagc3’ shell/ fruit f5’ggtgtcataacttcgttgttgct3’ r5’atgctcaaaagtgggtttctctc3’ open biomeĀ“trique des varieĀ“teĀ“ f5’cctcgaaggtgaagcaataaag3’ r5’actcatagagctttccacgacc3’ mesocarp mads-box transcription factor gct tat 3 ļæ½tude geĀ“neĀ“tique ssr-based genetic maps iso-amyl alcohol step pmc beta search transcription factor sequence trait-marker data resulted mads box agl11 mads-box genes transcription factor variants gov/data/oilseedsworld-markets marker–trait association analysis data availability statements genome-wide snp discovery kx465097-kx465106 pcr amplified product elaeis guineensis jacq elaeis guineensis jacq genbank accession number restriction site analysis high density snp bulk segregant analysis author mvb thankful publisher site pdf pcr product obtained tool restriction mapper multiple alignment option license information pmcid funding statement arabidopsis thaliana agamous amino acid composition amino acid patterns limited genetic background oil yield traits palm oil production arbidopsis thaliana agamous agl1 mrna sequences oil palm workers oil palm community oil palm researchers online tool expasy expasy online tool

External Links {šŸ”—}(60)

Analytics and Tracking {šŸ“Š}

  • Google Analytics
  • Google Analytics 4
  • Google Tag Manager

Libraries {šŸ“š}

  • jQuery
  • jQuery module (jquery-3.6.0)
  • Zoom.js

Emails and Hosting {āœ‰ļø}

Mail Servers:

  • nihcesxway.hub.nih.gov
  • nihcesxway2.hub.nih.gov
  • nihcesxway3.hub.nih.gov
  • nihcesxway4.hub.nih.gov
  • nihcesxway5.hub.nih.gov

Name Servers:

  • dns1-ncbi.ncbi.nlm.nih.gov
  • dns2-ncbi.ncbi.nlm.nih.gov
  • lhcns1.nlm.nih.gov
  • lhcns2.nlm.nih.gov

CDN Services {šŸ“¦}

  • Ncbi

3.48s.