Here's how NATURE.COM makes money* and how much!

*Please read our disclaimer before using our estimates.
Loading...

NATURE . COM {}

  1. Analyzed Page
  2. Matching Content Categories
  3. CMS
  4. Monthly Traffic Estimate
  5. How Does Nature.com Make Money
  6. How Much Does Nature.com Make
  7. Keywords
  8. Topics
  9. Questions
  10. Schema
  11. Social Networks
  12. External Links
  13. Analytics And Tracking
  14. Libraries
  15. Hosting Providers
  16. CDN Services

We are analyzing https://www.nature.com/articles/s41467-020-14337-6.

Title:
RADICL-seq identifies general and cell type鈥搒pecific principles of genome-wide RNA-chromatin interactions | Nature Communications
Description:
Mammalian genomes encode tens of thousands of noncoding RNAs. Most noncoding transcripts exhibit nuclear localization and several have been shown to play a role in the regulation of gene expression and chromatin remodeling. To investigate the function of such RNAs, methods to massively map the genomic interacting sites of multiple transcripts have been developed; however, these methods have some limitations. Here, we introduce RNA And DNA Interacting Complexes Ligated and sequenced (RADICL-seq), a technology that maps genome-wide RNA鈥揷hromatin interactions in intact nuclei. RADICL-seq is a proximity ligation-based methodology that reduces the bias for nascent transcription, while increasing genomic coverage and unique mapping rate efficiency compared with existing methods. RADICL-seq identifies distinct patterns of genome occupancy for different classes of transcripts as well as cell type鈥搒pecific RNA-chromatin interactions, and highlights the role of transcription in the establishment of chromatin structure. Mammalian genomes encode tens of thousands of ncRNAs that have important roles in regulation of gene expression and chromatin organization. Here, the authors present RADICLseq to map RNA-chromatin interactions in intact nuclei to shed light on these fine-tuned processes.
Website Age:
30 years and 10 months (reg. 1994-08-11).

Matching Content Categories {馃摎}

  • Education
  • Science
  • Video & Online Content

Content Management System {馃摑}

What CMS is nature.com built with?

Custom-built

No common CMS systems were detected on Nature.com, and no known web development framework was identified.

Traffic Estimate {馃搱}

What is the average monthly size of nature.com audience?

馃寙 Monumental Traffic: 20M - 50M visitors per month


Based on our best estimate, this website will receive around 42,555,829 visitors per month in the current month.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Nature.com Make Money? {馃捀}


Display Ads {馃幆}


The website utilizes display ads within its content to generate revenue. Check the next section for further revenue estimates.

Ads are managed by yourbow.com. Particular relationships are as follows:

Direct Advertisers (10)
google.com, pmc.com, doceree.com, yourbow.com, audienciad.com, onlinemediasolutions.com, advibe.media, aps.amazon.com, getmediamx.com, onomagic.com

Reseller Advertisers (38)
conversantmedia.com, rubiconproject.com, pubmatic.com, appnexus.com, openx.com, smartadserver.com, lijit.com, sharethrough.com, video.unrulymedia.com, google.com, yahoo.com, triplelift.com, onetag.com, sonobi.com, contextweb.com, 33across.com, indexexchange.com, media.net, themediagrid.com, adform.com, richaudience.com, sovrn.com, improvedigital.com, freewheel.tv, smaato.com, yieldmo.com, amxrtb.com, adyoulike.com, adpone.com, criteo.com, smilewanted.com, 152media.info, e-planning.net, smartyads.com, loopme.com, opera.com, mediafuse.com, betweendigital.com

How Much Does Nature.com Make? {馃挵}


Display Ads {馃幆}

$536,300 per month
Our analysis indicates Nature.com generates between $357,511 and $983,155 monthly online from display ads.

Keywords {馃攳}

interactions, rna, radiclseq, fig, pubmed, dna, supplementary, article, rnadna, google, scholar, cas, cell, genomic, data, genome, tags, reads, central, rnachromatin, transcripts, gridseq, mescs, total, chromatin, gene, expression, datasets, cells, rnas, number, regions, sequencing, observed, transcription, types, genes, nature, mopcs, min, noncoding, compared, binding, dataset, distance, cis, genomewide, tad, analysis, nuclear,

Topics {鉁掞笍}

nature portfolio privacy policy 5使-/5phos/ctgctgact/ibiodt/ggaccgtcggacc-3使 index rv primer pre-warmed phosphate-buffered saline poly-l-lysine-coated dishes advertising ultra end-repair/da-tailing module io/picard/ identify genome-wide rna鈥揷hromatin benjamini鈥揾ochberg multiple-testing correction discriminate cell-type-specific features stable nature genome-wide rna-chromatin interactions marie-sk艂odowska curie actions reprints double-stranded cdna鈥揹na complexes radicl-seq outperformed grid-seq swedish research council radicl-seq dna-binding patterns sequencing primer 5使-acactctttccctacacgacgctcttccgatct-3使 robust rna鈥揹na-interacting loci c-mapped paired-end reads actd-treated radicl-seq libraries malat1-decorated protein-coding genes preferentially open resulting rna鈥揳dapter鈥揹na chimera grid-seq captures considerably cell-type-specific manner nature nature 565 nature 539 nature 485 cancer research uk cell-type-specific patterns high-resolution promoterome mining radicl-seq identifies general cell type鈥搒pecific principles air-dried bead鈥搉uclei mixture mouse neural development pregastrulation mammalian development repeat聽elements differentially engage fully double-stranded dna proliferation media consisting genome-wide interaction plots maps genome-wide rna 5使-/5phos/ctgctgctccttccctttccccttttggtccgacggtccaagtcagcagt-3使 5使-/5phos/ggccctccaaaaggagggca-3使 5使-/5phos/gatcggaagagcgtcgtgtagggaaagagtgt-3使 y-shaped sequencing linkers

Questions {鉂搣

  • How do lncRNAs regulate transcription?
  • RNA dust: where are the genes?

Schema {馃椇锔弣

WebPage:
      mainEntity:
         headline:RADICL-seq identifies general and cell type芒聙聯specific principles of genome-wide RNA-chromatin interactions
         description:Mammalian genomes encode tens of thousands of noncoding RNAs. Most noncoding transcripts exhibit nuclear localization and several have been shown to play a role in the regulation of gene expression and chromatin remodeling. To investigate the function of such RNAs, methods to massively map the genomic interacting sites of multiple transcripts have been developed; however, these methods have some limitations. Here, we introduce RNA And DNA Interacting Complexes Ligated and sequenced (RADICL-seq), a technology that maps genome-wide RNA芒聙聯chromatin interactions in intact nuclei. RADICL-seq is a proximity ligation-based methodology that reduces the bias for nascent transcription, while increasing genomic coverage and unique mapping rate efficiency compared with existing methods. RADICL-seq identifies distinct patterns of genome occupancy for different classes of transcripts as well as cell type芒聙聯specific RNA-chromatin interactions, and highlights the role of transcription in the establishment of chromatin structure. Mammalian genomes encode tens of thousands of ncRNAs that have important roles in regulation of gene expression and chromatin organization. Here, the authors present RADICLseq to map RNA-chromatin interactions in intact nuclei to shed light on these fine-tuned processes.
         datePublished:2020-02-24T00:00:00Z
         dateModified:2021-05-19T00:00:00Z
         pageStart:1
         pageEnd:14
         license:http://creativecommons.org/licenses/by/4.0/
         sameAs:https://doi.org/10.1038/s41467-020-14337-6
         keywords:
            Biological techniques
            Chromatin
            Science
            Humanities and Social Sciences
            multidisciplinary
         image:
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig1_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig2_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig3_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig4_HTML.png
            https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig5_HTML.png
         isPartOf:
            name:Nature Communications
            issn:
               2041-1723
            volumeNumber:11
            type:
               Periodical
               PublicationVolume
         publisher:
            name:Nature Publishing Group UK
            logo:
               url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
               type:ImageObject
            type:Organization
         author:
               name:Alessandro Bonetti
               url:http://orcid.org/0000-0002-8099-4847
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
                     name:Karolinska Institutet
                     address:
                        name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                        type:PostalAddress
                     type:Organization
               email:[email protected]
               type:Person
               name:Federico Agostini
               url:http://orcid.org/0000-0002-5453-2737
               affiliation:
                     name:The Francis Crick Institute
                     address:
                        name:The Francis Crick Institute, London, UK
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Ana Maria Suzuki
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
                     name:Karolinska Institutet
                     address:
                        name:Department of Medicine (H7), Karolinska Institutet, Stockholm, Sweden
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Kosuke Hashimoto
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Giovanni Pascarella
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Juliette Gimenez
               url:http://orcid.org/0000-0001-7682-7088
               affiliation:
                     name:IRCCS Fondazione Santa Lucia
                     address:
                        name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Leonie Roos
               affiliation:
                     name:Institute of Clinical Sciences
                     address:
                        name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
                        type:PostalAddress
                     type:Organization
                     name:MRC London Institute of Medical Sciences
                     address:
                        name:MRC London Institute of Medical Sciences, London, UK
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Alex J. Nash
               affiliation:
                     name:Institute of Clinical Sciences
                     address:
                        name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
                        type:PostalAddress
                     type:Organization
                     name:MRC London Institute of Medical Sciences
                     address:
                        name:MRC London Institute of Medical Sciences, London, UK
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Marco Ghilotti
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Christopher J. 芒聙聣F. Cameron
               affiliation:
                     name:McGill University
                     address:
                        name:School of Computer Science, McGill University, Montr脙漏al, Canada
                        type:PostalAddress
                     type:Organization
                     name:McGill University
                     address:
                        name:Department of Biochemistry and Goodman Cancer Research Centre, McGill University, Montr脙漏al, Canada
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Matthew Valentine
               url:http://orcid.org/0000-0002-6382-5240
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Yulia A. Medvedeva
               affiliation:
                     name:Russian Academy of Science
                     address:
                        name:Institute of Bioengineering, Research Centre of Biotechnology, Russian Academy of Science, Moscow, Russia
                        type:PostalAddress
                     type:Organization
                     name:Russian Academy of Science
                     address:
                        name:Department of Computational Biology, Vavilov Institute of General Genetics, Russian Academy of Science, Moscow, Russia
                        type:PostalAddress
                     type:Organization
                     name:Moscow Institute of Physics and Technology
                     address:
                        name:Department of Biological and Medical Physics, Moscow Institute of Physics and Technology, Dolgoprudny, Russia
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Shuhei Noguchi
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Eneritz Agirre
               url:http://orcid.org/0000-0002-5012-0305
               affiliation:
                     name:Karolinska Institutet
                     address:
                        name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Kaori Kashi
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Samudyata
               affiliation:
                     name:Karolinska Institutet
                     address:
                        name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Joachim Luginb脙录hl
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Riccardo Cazzoli
               affiliation:
                     name:European Institute of Oncology IRCCS
                     address:
                        name:Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Saumya Agrawal
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Nicholas M. Luscombe
               url:http://orcid.org/0000-0001-5293-4778
               affiliation:
                     name:The Francis Crick Institute
                     address:
                        name:The Francis Crick Institute, London, UK
                        type:PostalAddress
                     type:Organization
                     name:University College London
                     address:
                        name:UCL Genetics Institute, University College London, London, UK
                        type:PostalAddress
                     type:Organization
                     name:Graduate University
                     address:
                        name:Okinawa Institute of Science and Technology, Graduate University, Okinawa, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Mathieu Blanchette
               affiliation:
                     name:McGill University
                     address:
                        name:School of Computer Science, McGill University, Montr脙漏al, Canada
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Takeya Kasukawa
               url:http://orcid.org/0000-0001-5085-0802
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Michiel de Hoon
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Erik Arner
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Boris Lenhard
               url:http://orcid.org/0000-0002-1114-1509
               affiliation:
                     name:Institute of Clinical Sciences
                     address:
                        name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
                        type:PostalAddress
                     type:Organization
                     name:MRC London Institute of Medical Sciences
                     address:
                        name:MRC London Institute of Medical Sciences, London, UK
                        type:PostalAddress
                     type:Organization
                     name:University of Bergen
                     address:
                        name:Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Charles Plessy
               url:http://orcid.org/0000-0001-7410-6295
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Gon脙搂alo Castelo-Branco
               url:http://orcid.org/0000-0003-2247-9393
               affiliation:
                     name:Karolinska Institutet
                     address:
                        name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                        type:PostalAddress
                     type:Organization
               type:Person
               name:Valerio Orlando
               affiliation:
                     name:IRCCS Fondazione Santa Lucia
                     address:
                        name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
                        type:PostalAddress
                     type:Organization
                     name:Division of Biological Environmental Sciences and Engineering
                     address:
                        name:KAUST Environmental Epigenetics Program, King Abdullah University of Science and Technology (KAUST), Division of Biological Environmental Sciences and Engineering, Thuwal, Saudi Arabia
                        type:PostalAddress
                     type:Organization
               email:[email protected]
               type:Person
               name:Piero Carninci
               url:http://orcid.org/0000-0001-7202-7243
               affiliation:
                     name:RIKEN Center for Integrative Medical Sciences
                     address:
                        name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                        type:PostalAddress
                     type:Organization
               email:[email protected]
               type:Person
         isAccessibleForFree:1
         type:ScholarlyArticle
      context:https://schema.org
ScholarlyArticle:
      headline:RADICL-seq identifies general and cell type芒聙聯specific principles of genome-wide RNA-chromatin interactions
      description:Mammalian genomes encode tens of thousands of noncoding RNAs. Most noncoding transcripts exhibit nuclear localization and several have been shown to play a role in the regulation of gene expression and chromatin remodeling. To investigate the function of such RNAs, methods to massively map the genomic interacting sites of multiple transcripts have been developed; however, these methods have some limitations. Here, we introduce RNA And DNA Interacting Complexes Ligated and sequenced (RADICL-seq), a technology that maps genome-wide RNA芒聙聯chromatin interactions in intact nuclei. RADICL-seq is a proximity ligation-based methodology that reduces the bias for nascent transcription, while increasing genomic coverage and unique mapping rate efficiency compared with existing methods. RADICL-seq identifies distinct patterns of genome occupancy for different classes of transcripts as well as cell type芒聙聯specific RNA-chromatin interactions, and highlights the role of transcription in the establishment of chromatin structure. Mammalian genomes encode tens of thousands of ncRNAs that have important roles in regulation of gene expression and chromatin organization. Here, the authors present RADICLseq to map RNA-chromatin interactions in intact nuclei to shed light on these fine-tuned processes.
      datePublished:2020-02-24T00:00:00Z
      dateModified:2021-05-19T00:00:00Z
      pageStart:1
      pageEnd:14
      license:http://creativecommons.org/licenses/by/4.0/
      sameAs:https://doi.org/10.1038/s41467-020-14337-6
      keywords:
         Biological techniques
         Chromatin
         Science
         Humanities and Social Sciences
         multidisciplinary
      image:
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig1_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig2_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig3_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig4_HTML.png
         https://media.springernature.com/lw1200/springer-static/image/art%3A10.1038%2Fs41467-020-14337-6/MediaObjects/41467_2020_14337_Fig5_HTML.png
      isPartOf:
         name:Nature Communications
         issn:
            2041-1723
         volumeNumber:11
         type:
            Periodical
            PublicationVolume
      publisher:
         name:Nature Publishing Group UK
         logo:
            url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
            type:ImageObject
         type:Organization
      author:
            name:Alessandro Bonetti
            url:http://orcid.org/0000-0002-8099-4847
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
                  name:Karolinska Institutet
                  address:
                     name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                     type:PostalAddress
                  type:Organization
            email:[email protected]
            type:Person
            name:Federico Agostini
            url:http://orcid.org/0000-0002-5453-2737
            affiliation:
                  name:The Francis Crick Institute
                  address:
                     name:The Francis Crick Institute, London, UK
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Ana Maria Suzuki
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
                  name:Karolinska Institutet
                  address:
                     name:Department of Medicine (H7), Karolinska Institutet, Stockholm, Sweden
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Kosuke Hashimoto
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Giovanni Pascarella
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Juliette Gimenez
            url:http://orcid.org/0000-0001-7682-7088
            affiliation:
                  name:IRCCS Fondazione Santa Lucia
                  address:
                     name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Leonie Roos
            affiliation:
                  name:Institute of Clinical Sciences
                  address:
                     name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
                     type:PostalAddress
                  type:Organization
                  name:MRC London Institute of Medical Sciences
                  address:
                     name:MRC London Institute of Medical Sciences, London, UK
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Alex J. Nash
            affiliation:
                  name:Institute of Clinical Sciences
                  address:
                     name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
                     type:PostalAddress
                  type:Organization
                  name:MRC London Institute of Medical Sciences
                  address:
                     name:MRC London Institute of Medical Sciences, London, UK
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Marco Ghilotti
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Christopher J. 芒聙聣F. Cameron
            affiliation:
                  name:McGill University
                  address:
                     name:School of Computer Science, McGill University, Montr脙漏al, Canada
                     type:PostalAddress
                  type:Organization
                  name:McGill University
                  address:
                     name:Department of Biochemistry and Goodman Cancer Research Centre, McGill University, Montr脙漏al, Canada
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Matthew Valentine
            url:http://orcid.org/0000-0002-6382-5240
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Yulia A. Medvedeva
            affiliation:
                  name:Russian Academy of Science
                  address:
                     name:Institute of Bioengineering, Research Centre of Biotechnology, Russian Academy of Science, Moscow, Russia
                     type:PostalAddress
                  type:Organization
                  name:Russian Academy of Science
                  address:
                     name:Department of Computational Biology, Vavilov Institute of General Genetics, Russian Academy of Science, Moscow, Russia
                     type:PostalAddress
                  type:Organization
                  name:Moscow Institute of Physics and Technology
                  address:
                     name:Department of Biological and Medical Physics, Moscow Institute of Physics and Technology, Dolgoprudny, Russia
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Shuhei Noguchi
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Eneritz Agirre
            url:http://orcid.org/0000-0002-5012-0305
            affiliation:
                  name:Karolinska Institutet
                  address:
                     name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Kaori Kashi
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Samudyata
            affiliation:
                  name:Karolinska Institutet
                  address:
                     name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Joachim Luginb脙录hl
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Riccardo Cazzoli
            affiliation:
                  name:European Institute of Oncology IRCCS
                  address:
                     name:Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Saumya Agrawal
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Nicholas M. Luscombe
            url:http://orcid.org/0000-0001-5293-4778
            affiliation:
                  name:The Francis Crick Institute
                  address:
                     name:The Francis Crick Institute, London, UK
                     type:PostalAddress
                  type:Organization
                  name:University College London
                  address:
                     name:UCL Genetics Institute, University College London, London, UK
                     type:PostalAddress
                  type:Organization
                  name:Graduate University
                  address:
                     name:Okinawa Institute of Science and Technology, Graduate University, Okinawa, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Mathieu Blanchette
            affiliation:
                  name:McGill University
                  address:
                     name:School of Computer Science, McGill University, Montr脙漏al, Canada
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Takeya Kasukawa
            url:http://orcid.org/0000-0001-5085-0802
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Michiel de Hoon
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Erik Arner
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Boris Lenhard
            url:http://orcid.org/0000-0002-1114-1509
            affiliation:
                  name:Institute of Clinical Sciences
                  address:
                     name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
                     type:PostalAddress
                  type:Organization
                  name:MRC London Institute of Medical Sciences
                  address:
                     name:MRC London Institute of Medical Sciences, London, UK
                     type:PostalAddress
                  type:Organization
                  name:University of Bergen
                  address:
                     name:Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Charles Plessy
            url:http://orcid.org/0000-0001-7410-6295
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Gon脙搂alo Castelo-Branco
            url:http://orcid.org/0000-0003-2247-9393
            affiliation:
                  name:Karolinska Institutet
                  address:
                     name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
                     type:PostalAddress
                  type:Organization
            type:Person
            name:Valerio Orlando
            affiliation:
                  name:IRCCS Fondazione Santa Lucia
                  address:
                     name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
                     type:PostalAddress
                  type:Organization
                  name:Division of Biological Environmental Sciences and Engineering
                  address:
                     name:KAUST Environmental Epigenetics Program, King Abdullah University of Science and Technology (KAUST), Division of Biological Environmental Sciences and Engineering, Thuwal, Saudi Arabia
                     type:PostalAddress
                  type:Organization
            email:[email protected]
            type:Person
            name:Piero Carninci
            url:http://orcid.org/0000-0001-7202-7243
            affiliation:
                  name:RIKEN Center for Integrative Medical Sciences
                  address:
                     name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
                     type:PostalAddress
                  type:Organization
            email:[email protected]
            type:Person
      isAccessibleForFree:1
["Periodical","PublicationVolume"]:
      name:Nature Communications
      issn:
         2041-1723
      volumeNumber:11
Organization:
      name:Nature Publishing Group UK
      logo:
         url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
         type:ImageObject
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Karolinska Institutet
      address:
         name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
         type:PostalAddress
      name:The Francis Crick Institute
      address:
         name:The Francis Crick Institute, London, UK
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Karolinska Institutet
      address:
         name:Department of Medicine (H7), Karolinska Institutet, Stockholm, Sweden
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:IRCCS Fondazione Santa Lucia
      address:
         name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
         type:PostalAddress
      name:Institute of Clinical Sciences
      address:
         name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
         type:PostalAddress
      name:MRC London Institute of Medical Sciences
      address:
         name:MRC London Institute of Medical Sciences, London, UK
         type:PostalAddress
      name:Institute of Clinical Sciences
      address:
         name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
         type:PostalAddress
      name:MRC London Institute of Medical Sciences
      address:
         name:MRC London Institute of Medical Sciences, London, UK
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:McGill University
      address:
         name:School of Computer Science, McGill University, Montr脙漏al, Canada
         type:PostalAddress
      name:McGill University
      address:
         name:Department of Biochemistry and Goodman Cancer Research Centre, McGill University, Montr脙漏al, Canada
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Russian Academy of Science
      address:
         name:Institute of Bioengineering, Research Centre of Biotechnology, Russian Academy of Science, Moscow, Russia
         type:PostalAddress
      name:Russian Academy of Science
      address:
         name:Department of Computational Biology, Vavilov Institute of General Genetics, Russian Academy of Science, Moscow, Russia
         type:PostalAddress
      name:Moscow Institute of Physics and Technology
      address:
         name:Department of Biological and Medical Physics, Moscow Institute of Physics and Technology, Dolgoprudny, Russia
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Karolinska Institutet
      address:
         name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Karolinska Institutet
      address:
         name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:European Institute of Oncology IRCCS
      address:
         name:Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:The Francis Crick Institute
      address:
         name:The Francis Crick Institute, London, UK
         type:PostalAddress
      name:University College London
      address:
         name:UCL Genetics Institute, University College London, London, UK
         type:PostalAddress
      name:Graduate University
      address:
         name:Okinawa Institute of Science and Technology, Graduate University, Okinawa, Japan
         type:PostalAddress
      name:McGill University
      address:
         name:School of Computer Science, McGill University, Montr脙漏al, Canada
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Institute of Clinical Sciences
      address:
         name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
         type:PostalAddress
      name:MRC London Institute of Medical Sciences
      address:
         name:MRC London Institute of Medical Sciences, London, UK
         type:PostalAddress
      name:University of Bergen
      address:
         name:Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
      name:Karolinska Institutet
      address:
         name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
         type:PostalAddress
      name:IRCCS Fondazione Santa Lucia
      address:
         name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
         type:PostalAddress
      name:Division of Biological Environmental Sciences and Engineering
      address:
         name:KAUST Environmental Epigenetics Program, King Abdullah University of Science and Technology (KAUST), Division of Biological Environmental Sciences and Engineering, Thuwal, Saudi Arabia
         type:PostalAddress
      name:RIKEN Center for Integrative Medical Sciences
      address:
         name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
         type:PostalAddress
ImageObject:
      url:https://www.springernature.com/app-sn/public/images/logo-springernature.png
Person:
      name:Alessandro Bonetti
      url:http://orcid.org/0000-0002-8099-4847
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
            name:Karolinska Institutet
            address:
               name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
               type:PostalAddress
            type:Organization
      email:[email protected]
      name:Federico Agostini
      url:http://orcid.org/0000-0002-5453-2737
      affiliation:
            name:The Francis Crick Institute
            address:
               name:The Francis Crick Institute, London, UK
               type:PostalAddress
            type:Organization
      name:Ana Maria Suzuki
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
            name:Karolinska Institutet
            address:
               name:Department of Medicine (H7), Karolinska Institutet, Stockholm, Sweden
               type:PostalAddress
            type:Organization
      name:Kosuke Hashimoto
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Giovanni Pascarella
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Juliette Gimenez
      url:http://orcid.org/0000-0001-7682-7088
      affiliation:
            name:IRCCS Fondazione Santa Lucia
            address:
               name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
               type:PostalAddress
            type:Organization
      name:Leonie Roos
      affiliation:
            name:Institute of Clinical Sciences
            address:
               name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
               type:PostalAddress
            type:Organization
            name:MRC London Institute of Medical Sciences
            address:
               name:MRC London Institute of Medical Sciences, London, UK
               type:PostalAddress
            type:Organization
      name:Alex J. Nash
      affiliation:
            name:Institute of Clinical Sciences
            address:
               name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
               type:PostalAddress
            type:Organization
            name:MRC London Institute of Medical Sciences
            address:
               name:MRC London Institute of Medical Sciences, London, UK
               type:PostalAddress
            type:Organization
      name:Marco Ghilotti
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Christopher J. 芒聙聣F. Cameron
      affiliation:
            name:McGill University
            address:
               name:School of Computer Science, McGill University, Montr脙漏al, Canada
               type:PostalAddress
            type:Organization
            name:McGill University
            address:
               name:Department of Biochemistry and Goodman Cancer Research Centre, McGill University, Montr脙漏al, Canada
               type:PostalAddress
            type:Organization
      name:Matthew Valentine
      url:http://orcid.org/0000-0002-6382-5240
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Yulia A. Medvedeva
      affiliation:
            name:Russian Academy of Science
            address:
               name:Institute of Bioengineering, Research Centre of Biotechnology, Russian Academy of Science, Moscow, Russia
               type:PostalAddress
            type:Organization
            name:Russian Academy of Science
            address:
               name:Department of Computational Biology, Vavilov Institute of General Genetics, Russian Academy of Science, Moscow, Russia
               type:PostalAddress
            type:Organization
            name:Moscow Institute of Physics and Technology
            address:
               name:Department of Biological and Medical Physics, Moscow Institute of Physics and Technology, Dolgoprudny, Russia
               type:PostalAddress
            type:Organization
      name:Shuhei Noguchi
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Eneritz Agirre
      url:http://orcid.org/0000-0002-5012-0305
      affiliation:
            name:Karolinska Institutet
            address:
               name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
               type:PostalAddress
            type:Organization
      name:Kaori Kashi
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Samudyata
      affiliation:
            name:Karolinska Institutet
            address:
               name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
               type:PostalAddress
            type:Organization
      name:Joachim Luginb脙录hl
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Riccardo Cazzoli
      affiliation:
            name:European Institute of Oncology IRCCS
            address:
               name:Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy
               type:PostalAddress
            type:Organization
      name:Saumya Agrawal
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Nicholas M. Luscombe
      url:http://orcid.org/0000-0001-5293-4778
      affiliation:
            name:The Francis Crick Institute
            address:
               name:The Francis Crick Institute, London, UK
               type:PostalAddress
            type:Organization
            name:University College London
            address:
               name:UCL Genetics Institute, University College London, London, UK
               type:PostalAddress
            type:Organization
            name:Graduate University
            address:
               name:Okinawa Institute of Science and Technology, Graduate University, Okinawa, Japan
               type:PostalAddress
            type:Organization
      name:Mathieu Blanchette
      affiliation:
            name:McGill University
            address:
               name:School of Computer Science, McGill University, Montr脙漏al, Canada
               type:PostalAddress
            type:Organization
      name:Takeya Kasukawa
      url:http://orcid.org/0000-0001-5085-0802
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Michiel de Hoon
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Erik Arner
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Boris Lenhard
      url:http://orcid.org/0000-0002-1114-1509
      affiliation:
            name:Institute of Clinical Sciences
            address:
               name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
               type:PostalAddress
            type:Organization
            name:MRC London Institute of Medical Sciences
            address:
               name:MRC London Institute of Medical Sciences, London, UK
               type:PostalAddress
            type:Organization
            name:University of Bergen
            address:
               name:Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway
               type:PostalAddress
            type:Organization
      name:Charles Plessy
      url:http://orcid.org/0000-0001-7410-6295
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      name:Gon脙搂alo Castelo-Branco
      url:http://orcid.org/0000-0003-2247-9393
      affiliation:
            name:Karolinska Institutet
            address:
               name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
               type:PostalAddress
            type:Organization
      name:Valerio Orlando
      affiliation:
            name:IRCCS Fondazione Santa Lucia
            address:
               name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
               type:PostalAddress
            type:Organization
            name:Division of Biological Environmental Sciences and Engineering
            address:
               name:KAUST Environmental Epigenetics Program, King Abdullah University of Science and Technology (KAUST), Division of Biological Environmental Sciences and Engineering, Thuwal, Saudi Arabia
               type:PostalAddress
            type:Organization
      email:[email protected]
      name:Piero Carninci
      url:http://orcid.org/0000-0001-7202-7243
      affiliation:
            name:RIKEN Center for Integrative Medical Sciences
            address:
               name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
               type:PostalAddress
            type:Organization
      email:[email protected]
PostalAddress:
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
      name:The Francis Crick Institute, London, UK
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Department of Medicine (H7), Karolinska Institutet, Stockholm, Sweden
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
      name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
      name:MRC London Institute of Medical Sciences, London, UK
      name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
      name:MRC London Institute of Medical Sciences, London, UK
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:School of Computer Science, McGill University, Montr脙漏al, Canada
      name:Department of Biochemistry and Goodman Cancer Research Centre, McGill University, Montr脙漏al, Canada
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Institute of Bioengineering, Research Centre of Biotechnology, Russian Academy of Science, Moscow, Russia
      name:Department of Computational Biology, Vavilov Institute of General Genetics, Russian Academy of Science, Moscow, Russia
      name:Department of Biological and Medical Physics, Moscow Institute of Physics and Technology, Dolgoprudny, Russia
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Department of Experimental Oncology, IEO, European Institute of Oncology IRCCS, Milan, Italy
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:The Francis Crick Institute, London, UK
      name:UCL Genetics Institute, University College London, London, UK
      name:Okinawa Institute of Science and Technology, Graduate University, Okinawa, Japan
      name:School of Computer Science, McGill University, Montr脙漏al, Canada
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Faculty of Medicine, Imperial College London, Institute of Clinical Sciences, London, UK
      name:MRC London Institute of Medical Sciences, London, UK
      name:Sars International Centre for Marine Molecular Biology, University of Bergen, Bergen, Norway
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan
      name:Laboratory of Molecular Neurobiology, Department Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden
      name:Epigenetics and Genome Reprogramming Laboratory, IRCCS Fondazione Santa Lucia, Rome, Italy
      name:KAUST Environmental Epigenetics Program, King Abdullah University of Science and Technology (KAUST), Division of Biological Environmental Sciences and Engineering, Thuwal, Saudi Arabia
      name:RIKEN Center for Integrative Medical Sciences, Yokohama, Japan

External Links {馃敆}(336)

Analytics and Tracking {馃搳}

  • Google Tag Manager

Libraries {馃摎}

  • Prism.js
  • Zoom.js

Emails and Hosting {鉁夛笍}

Mail Servers:

  • mxa-002c5801.gslb.pphosted.com
  • mxb-002c5801.gslb.pphosted.com

Name Servers:

  • pdns1.ultradns.net
  • pdns2.ultradns.net
  • pdns3.ultradns.org
  • pdns4.ultradns.org
  • pdns5.ultradns.info
  • pdns6.ultradns.co.uk

CDN Services {馃摝}

  • Crossref

5.38s.