SAMTOOLS . SOURCEFORGE . NET {}

Matching Content Categories {📚}

• Telecommunications
• Video & Online Content
• Virtual Reality

Content Management System {📝}

What CMS is samtools.sourceforge.net built with?

Custom-built

No common CMS systems were detected on Samtools.sourceforge.net, and no known web development framework was identified.

Traffic Estimate {📈}

What is the average monthly size of samtools.sourceforge.net audience?

🚦 Initial Traffic: less than 1k visitors per month


Based on our best estimate, this website will receive around 119 visitors per month in the current month.
However, some sources were not loaded, we suggest to reload the page to get complete results.

check SE Ranking
check Ahrefs
check Similarweb
check Ubersuggest
check Semrush

How Does Samtools.sourceforge.net Make Money? {💸}

We don't see any clear sign of profit-making.

Not all websites are made for profit; some exist to inform or educate users. Or any other reason why people make websites. And this might be the case. Samtools.sourceforge.net could have a money-making trick up its sleeve, but it's undetectable for now.

Keywords {🔍}

samtools, bcftools, base, read, format, view, calling, sum, file, samples, vcf, indel, bases, nonref, command, reference, reffa, data, baq, information, line, bcf, afs, alignment, indels, mpileup, snp, sample, variant, list, call, snps, reads, ref, qualities, allele, pchi, lines, phredscaled, tail, distance, pvalue, files, alnbam, genotype, mapping, quality, strand, frequency, field,

Topics {✒️}

�    echo samtools mpileup -c50 -m3 -f0 net/projects/samtools/files/tabix/tabix-0 cp sort $home/bin/sort-alt pl varfilter -10 -20 -30 -40 -a4 -g90 -s30 run samtools calmd -abr aln bcf   bcftools view -cgp cond2 cond net/svnroot/samtools/trunk/samtools afs   bcftools view -cgp round2 net/download/asub   wget http cp tabix bgzip $home/bin gz   bcftools view -bl target afs   bcftools view -cgp round1 pl $home/bin   wget http bz2/download   tar -jxf tabix-0 pl   cp asub bedutils pl varfilter -w0 -10 -20 -30 -40 -q0  cp samtools bcftools/{bcftools bcftools view -gm target bcftools view -nibl cond gz   tabix -fpvcf merge bcf   bcftools view var minus phred-scaled probability gz   sort-alt -k1 samtools mpileup -uf ref count low-quality bases bz2   tar -jxf sort-20101217 phred-scaled pchi2 rp site-independent snp callers net/download/sort-20101217 phred-scaled data likelihoods bcf   bcftools index merge net/download/bedutils read equals min{k-1 time-demanding baq calculation aattaagtctacagagcaacta read3 echo grep ^part-{}  pl} $home/bin cases snp/indel calling source code package multi-allelic indels procedure calling snps/indels multi-sequence realignment phred-scaled probability samtools/bcftools versions bcftools view -cg  retrieve target regions xargs tabix merge sample names starting low-quality bases

External Links {🔗}(8)

• How much profit is http://sourceforge.net making per month?
• How much does http://github.com earn?
• How much profit does http://www.htslib.org/ make?
• What's the total monthly financial gain of http://vcftools.sourceforge.net/specs.html?
• Get to know what's the income of http://lh3lh3.users.sourceforge.net/download/asub
• What's the income generated by http://lh3lh3.users.sourceforge.net/download/bedutils.pl each month?
• Monthly income for http://lh3lh3.users.sourceforge.net/download/sort-20101217.tar.bz2
• What's the revenue for http://sourceforge.net/projects/samtools/files/tabix/?